Musicians still needed for Bye Bye Birdie. Show is produced by META Performing Arts and will run at McIntyre Hall later November 2007. Show dates and details are at http://www.conradaskland.com/blog/2007/07/bye-bye-birdie-musician-page/
MUSICIAN SPOTS STILL OPEN:
Timpani/Percussion
Drums (Trap Set)
Alto Sax
Trombone II
Trumpet III
Contact Conrad if interested in auditioning. We will have a full pit orchestra for this production.
Share on [...]
TWO NIGHTS ONLY!
Northwest Theatre Arts/the Conway Muse
Proudly present
Cabaret Flambé
The Lincoln Theatre
(360) 336-8955
Friday and Saturday
October 12th & 13th @ 8 PM
Featuring
NANDA
Northwest Theatre Arts (producers of the Moulin Rouge Cabaret) proudly presents Cabaret Flambé, an unforgettable night of song, dance, laughter and intrigue served in a New Orleans club setting. Features special guests, NANDA, an amazing juggling, [...]
Continue reading about Cabaret Flambe – Oct 12-13 2007 – Lincoln Theater
September 2004 – “New Age” is a term that’s lost a bit of it’s luster over the years. In theology it’s better represented by “New Thought”, but in music the term New Age still holds to describe a genre of instrumental music that is thoughtful, usually instrumental, and a great background for keeping with our [...]
If you look at this picture and just see a guy standing next to an organ – I must inform you it is MUCH more than that. I have exciting news for any fans of the Lincoln Theater in Mount Vernon, WA – fans of Wurlitzer organs and fans of the Rocky Horror Show.
What [...]
Continue reading about Lincoln Theater Remote Wurlitzer Organ
This was my view while conducting Brigadoon at the Kirkland Performance Center in September 2007. Several people asked me for an explanation of the wired contraption you see in the middle of the photo. One child in particular spent most the show trying to figure it out and had some great guesses about it.
The item [...]
Another great season for Shakespeare Northwest with Twelfth Night and Measure for Measure. I saw 12th Night and it was fantastic. My life is now incomplete knowing that I missed their production of Measure for Measure. Productions of the Bard’s work takes place outdoors by the Skagit River in Mount Vernon, WA.
The park is [...]
Lyrics to Bohemian Rhapsody by Queen
Is this the real life-
Is this just fantasy-
Caught in a landslide-
No escape from reality-
Open your eyes
Look up to the skies and see-
Im just a poor boy,i need no sympathy-
Because Im easy come,easy go,
A little high,little low,
Anyway the wind blows,doesnt really matter to me,
To me
Mama,just killed a man,
Put a gun against [...]
Sadly, an Honest Creationist
by Richard Dawkins
The following article is from Free Inquiry magazine, Volume 21, Number 4.
Creation “scientists†have more need than most of us to parade their degrees and qualifications, but it pays to look closely at the institutions that awarded them and the subjects in which they were taken. Those vaunted Ph.D.s tend [...]
Â
LOS ANGELES, CA – In a category packed with worthy nominees, the Disney Channel movie High School Musical took home the Emmy Award on Sunday for Best Television Programming With Gay Subtext. The Emmy was presented by former West Wing stars Bradley Whitford and Rob Lowe to Musical director Kenny Ortega, who won the [...]
Continue reading about High School Musical Wins Gay Subtext Emmy
�
News Release from GeoDezik.com:
Cirque Du Soleil – Macao, China / Chine
(French) – Geodezik conçoit présentement les projections vidéo d’un nouveau spectacle permanent du Cirque du Soleil qui sera présenté � partir de 2008 � Macao en Chine. Sous la direction du metteur en scène Gilles Maheu et en collaboration avec le scénographe [...]
Continue reading about GeoDezik Projection Design for Macao Cirque Show
Destination Macau Report — Ep 9 – The Venetian Macau
Share on Facebook
1. Light travels faster than sound. This is why some people appear bright until you hear them speak.
2. A fine is a tax for doing wrong. A tax is a fine for doing well.
3. He who laughs last, thinks slowest.
4. A day without sunshine is like, well, night.
5. Change is inevitable, except from a vending [...]
Question received via email about finding the right tempo:
Hi there
I am a song writer who is having trouble with finding the right tempo. Many of my songs are constructed on basslines, drum beats, riffs or vocals and I feel that everything is recorded at it’s most suitable timing. However, something lacks in [...]
The Soul Plays by Nicola Pearson
Phillip Tarro Theater, Skagit Valley College Campus
Thursday, Sept. 27 – 2:30pm
Friday and Saturday, Sept. 28 & 29 at 7:30 pm.
Tickets are $5 and you can call (360) 416 7723 for information and reservations.
This is a great opportunity for those of you who didn’t get a chance to see “The [...]
Thank you to the authors of this published study for choosing my nature sound recordings to use on your experiments.
Integrating audiovisual information for the control of overt attention
Selim Onat – Institute of Cognitive Science, University of Osnabrück, Germany
Klaus Libertus – Institute of Cognitive Science, University of Osnabrück, Germany, & Department of Psychology & Neuroscience, Duke [...]
Continue reading about Integrating audiovisual information for the control of overt attention
Here’s a comparison between the cytochrome-C coding in humans and chimps. Differences are marked by gaps in the asterisks.
human_cytc
ATGGGTGATGTTGAGAAAGGCAAGAAGATTTTTATTATGAAGTGTTCCCAGTGCCACACC
chimp_cytc
ATGGGTGATGTTGAGAAAGGCAAGAAGATTTTTATTATGAAGTGTTCCCAGTGCCATACC
******************************************************** ***
human_cytc
GTTGAAAAGGGAGGCAAGCACAAGACTGGGCCAAATCTCCATGGTCTCTTTGGGCGGAAG
chimp_cytc
GTTGAAAAGGGAGGCAAGCACAAGACTGGGCCAAATCTCCATGGTCTCTTCGGGCGGAAG
************************************************** *********
human_cytc
ACAGGTCAGGCCCCTGGATACTCTTACACAGCCGCCAATAAGAACAAAGGCATCATCTGG
chimp_cytc
ACAGGTCAGGCCCCTGGATATTCTTACACAGCCGCCAATAAGAACAAAGGCATCATCTGG
******************** ***************************************
human_cytc
GGAGAGGATACACTGATGGAGTATTTGGAGAATCCCAAGAAGTACATCCCTGGAACAAAA
chimp_cytc
GGAGAGGATACACTGATGGAGTATTTGGAGAATCCCAAGAAGTACATCCCTGGAACAAAA
************************************************************
human_cytc
ATGATCTTTGTCGGCATTAAGAAGAAGGAAGAAAGGGCAGACTTAATAGCTTATCTCAAA
chimp_cytc
ATGATATTTGTCGGCATTAAGAAGAAGGAAGAAAGGGCAGACTTAATAGCTTATCTCAAA
***** ******************************************************
human_cytc
AAAGCTACTAATGAGTAA
chimp_cytc
AAAGCTACTAATGAGTAA
******************
Share on Facebook
Continue reading about Cytochrome-C coding comparison in humans and chimps
Â
Rev. Dr. Reggie McNeil is coming to Puget Sound to present:
Spiritual Leadership for the Present Future Church
Saturday, September 22, 2007, 9am – 3pm
North Creek Presbyterian Church
621 164th Street SE
Mill Creek, WA 98012
Visit http://www.npspresbytery.org for more details
Engage Reggie as a team or come on your own.
Event Fee:
$25 includes seminar, materials and lunch
$10 for North Puget [...]
Hi!
I just wanted to know, how can i do to redirect all the 404 errors (Page not found) to the index of my website.
Thanks!
*******************************
Have a file at in the public_html or htdocs folder of your website called .htaccess with this in it:
ErrorDocument 404 /index.html
Share on Facebook
Press release concerning all the new shows on the way with Cirque…
Putting Creation First
CIRQUE DU SOLEIL OFFERS STIMULATING CREATIVE PLATFORMS
FOR CREATORS FROM HOME AND ABROAD
Montreal, September 13, 2007 – Ever since its founding in 1984, Cirque du Soleil has chosen to empower its creators and make creation the focal point of its activities. Over the [...]
Continue reading about Cirque Du Soleil Upcoming Shows Info 2007
Autry created the Cowboy Code or Cowboy Commandments in response to his young radio listeners aspiring to be just like Gene. I used to play keyboards for Roy Rogers Jr. – see Roy Rogers and Gene Autry had a friendly rivalry between them, all in good fun. But I’d bet my saddle that Roy would [...]









Recent Comments